sequence - R: How to use output of 'translate' function to write a table? -


i have file (data.txt) contains 2 dna sequences (orf):

data = readdnastringset(file="data.txt")  data # dnastringset instance of length 2 # width seq                                                       names #[1]  57 atgacccccacctccatccccacacttctatcccgctgccccgcctctctcccctaa  gpg #[2]  54 atgacccatgagcaccatgcagccaaaaccctgggaatcggcaaagccatctag     pfk 

i want convert them aminoacids:

t=vector(mode="list", length=length(data)) (i in seq_along(data)) { t[[i]]=translate(data[[i]]) } t #[[1]] #19-letter "aastring" instance #seq: mtptsiptllsrcpaslp*  #[[2]] #18-letter "aastring" instance #seq: mthehhaaktlgigkai* 

then write table , have output using:

tt=do.call(rbind,t) write.table(tt,"aa.txt",sep="\t\t") 

but these commands don't work. couldn't find problem. how can write table?

note: translate function [seqinr] , readdnastringset function [biostrings].

i don't know why need seqinr. biostrings need.

library("biostrings")  dna <- readdnastringset(file="data.txt") aa <- translate(dna)  write.table(as.character(aa), file="aa.txt", sep="\t\t") 

maybe want use writexstringset instead of write.table.


Comments